Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was applied as an internal positive control. The primers in this study were as follows: GAPDH: sense 5′- ACCACAGTCCATGCCATCAC -3′, antisense 5′- TCCACCACCCTGTTGCTGTA

-3′; VEGF: sense 5′- TGGATCCATGAACTTTCTGCTGTC -3′, this website antisense 5′- TCACCGCCTTGGCTTGTCACAT -3′; IL-8: sense 5′-CTTTGTCCATTCCCACTTCTGA-3′, antisense 5′-TCCCTAACGGTTGCCTTTGTA T-3′; IL-6: sense 5′- ATGAACTCCTTCTCCACAAGCGC -3′, antisense 5′- GAAGAGCCCTCAGGCTGGACTG -3′ [12, 39–41]. The PCR cycler condition was according to the recommendations in the manufacturer’s instructions. Reactions were performed in a 25-μL volume and each sample was run at least in duplicate. The levels of expression of VEGF, IL-8, and IL-6 mRNA in each sample were normalized to the GAPDH mRNA level. The relative expression of VEGF, IL-8, and IL-6 mRNA was calculated applying the comparative CT method [18, 39]. Statistical analysis The data are expressed as the mean ± SD. Changes in protein and mRNA levels of VEGF, IL-8 and IL-6, the averaged tumor volume and weight were calculated by one way analysis of variance (ANOVA) with an LSD post-hoc test and an unpaired student’ t test using SPSS, click here version 15.0 (SPSS, Chicago, IL). A p

value less than 0.05 was considered as statistically significant. Results NE upregulates VEGF, IL-8, and IL-6 protein levels in culture supernatants of B16F1 (with or without sunitinib) and A549 cells, which can be blocked by propranolol A NE dose-dependent and time-dependent increase in VEGF, IL-8 and IL-6 protein levels in culture supernatants of both B16F1 and A549 cells with a peak increase at the 6 hours time point and 10 μM concentration, which could be blocked by 10 μM propranolol (Figure  1A-F). In A549 cells, treatment with

10 μM NE for 6 h caused a remarkable increase to 242.79 ± 19.86%, 331.56 ± 24.41% and 685.85 ± 34.72% (P < 0.001) of control levels for VEGF, IL-8 and IL-6 protein levels, respectively (Figure  1A-C). Likewise, in B16F1 cells, VEGF, IL-8 and IL-6 protein levels arrived at 185.15 ± 12.13%, 301.35 ± 24.98% and 294.40 ± 23.17% (P < 0.001) of control levels in response to exposure to 10 μM NE for 6 hours (Figure  1D-F). Overall, the increase Glutathione peroxidase could be most seen in both two cells at the NE concentration ranging from 0.1 to 10 μM since 3 hours after treatment. However, as time went on, the extent of the increase reduced 6 hours later. Figure 1 Effect of NE in vitro (with or without sunitinib). VEGF, IL-8 and IL-6 protein levels in culture supernatants by A549 (A, B, and C) and B16F1 (D, E and F) cells were measured after incubation with 0 (CON), 0.1, 1, 10 μM NE and 10 μM NE + 10 μM PROP for 3, 6, 12 and 24 hours. The levels of VEGF, IL-8, and IL-6 protein in B16F1 (G, H and I) cells incubated with 3.35 μM SUN alone (CON), 3.35 μM SUN + 10 μM NE, 3.