The cDNAs were synthesized with the ThermoScript RT-PCR system kit (Invitrogen). The alaS gene was used as the endogenous control [13]. The primers used in
the experiments were designed with the Primer3 program http://frodo.wi.mit.edu/, employing the entire coding region of the selected genes from the A. ferrooxidans ATCC 23270 genome (Table 1). The specificity of the primers was confirmed by PCR using genomic DNA from A. ferrooxidans LR. Table 1 Primers used in the real-time PCR experiments. Target gene Forward primer (5′ → 3′) Reverse primer PR-171 mw (5 ‘→ 3′) Amplicon length (bp) Afe_1009 CCGAAATACCTGAGGTCAA TCCCTTTCTCCTCCTTCTCC 91 Afe_1437 TGF-beta inhibitor GTATTGAAGGCGGAGATTGC TCTTCTTCCTTGACGCCACT 118 Afe_2172 AGGTAATCTTCAGCGGCAAC TAGGGGATCTCCAGACGATG 97 The qRT-PCR experiments were performed in triplicate SB202190 in vitro using a 7500 Real Time PCR System (Applied Biosystems), and threshold cycle (Ct) numbers were determined using Real Time System RQ Study Software v. 1.3.1 (Applied Biosystems). The qRT-PCR reactions were performed in triplicate using Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen). After thermal cycling, a dissociation (melting) curve analysis was performed to ensure the specificity
of the amplifications and the absence of primer-dimer and unspecific amplifications. The relative gene expression was calculated according to the comparative critical threshold method (ΔΔTC) described by Livak and Schmittgen [14]. The statistical significance of the qRT-PCR data was determined using the Student’s t-test (p-value ≤ 0.05). Bioinformatics analysis The A. ferrooxidans ATCC 23270 genome (J. Craig Venter Institute – http://cmr.jcvi.org/cgi-bin/CMR/Genome) was used to search for genes encoding sHSPs. CLUSTAL W was employed to align the sHSP sequences from A. ferrooxidans with sequences found in other bacteria. The alignment was edited with the GeneDoc program [15]. Prediction of the transcription dipyridamole start site was performed with BPROM
software (Softberry, Inc.). A widely accepted theoretical informational approach was adopted to identify potential σ32 sites [16, 17]. Since the σ32 binding site comprises two conserved blocks (-35 and -10), separated by a gap of variable length, two positional weight matrices (PWM) were generated, each one based on complementary information from the -35 and -10 binding sites. The frequency matrix was based on a set of eighteen V. cholerae σ32 promoters [18], including the extended σ32 promoter, with 6 positions in the -35 element and 8 positions in the -10 element, separated by a spacer of variable length. Using the PWMs as a scoring function, putative -35 and -10 regions of σ32 were searched on 200 bases upstream from the ATG start codon of the A. ferrooxidans sHSP genes. Each site was scored for its degree of matching to the σ32 -35 and -10 PWMs.